Statistical Analysis Jobs

Need someone good expert in forecasting and case study

Need support in Statistics questions - practical questions.

I need someone who can pull data (need to write a code in python to pull the data from the website and automate it). once you have the data then you need to analyze it, I will discuss those points in PM and finally prepare the presentation and provide recommendations. Thanks

Statistical analysis is needed to be done for a secondary database, which needs descriptive statistical analysis to see the relationship between dependent and independent variables, also Chi-square tests and Logistic regression analysis. For a cross-sectional study in malnutrition.

Analyze follower statistics, engagement Research strengths & weaknesses of current social media patterns Instagram, twitter & Facebook? Develop, implement and manage social media strategy and campaigns for Instagram, Twitter & Facebook Work with our Social Media Content Creator & Scheduler to create the best esthetics for each platforms to attract followers and create organic engag...

Use the data to conduct profitability comparative analysis Use software modeling to do linear regression analysis. Need methodology and result discussion

Logistic regression report, including: - Introduction - Exploratory analysis - From initial to final model - Results - Comments about the data/analysis - Interpretation and conclusions for a lay audience

You are going to research on the issues concerning the use of data mining for (a) particular functional area(s). The suggested areas include, but not limited to: • Data Mining and Customer Relationship Management (CRM) • Data Mining and Marketing • Data Mining and Fraud Detection • Data Mining and Talent Management, etc.

A systematic review of the effectiveness of human resources and training in improving services and support for older people with mental health problems

I need basic analysis on DNA Eg: ATGCCCCAACTAAATACCGCCGTATGACCCACCATAATTACCCCCATACTCCTGACACTATTTCTCGTCACCCAACTAAAAATATTAAATTCAAATTACCATCTACCCCCCTCACCAAAACCCATAAAAATAAAAAACTACAATAAACCCTGAGAACCAAAATGAACGAAAATCTATTCGCTTCATTCGCTGCCCCCACAATCCTAG

Use the data to conduct profitability comparative analysis Use software modeling to do linear regression analysis. Need methodology and result discussion

Business forecasting 307 ....

Being a professional quantitative data analysis provider, I offer the following services: #Descriptive analysis of survey data with SPSS # Inferrential analysis of survey data with SPSS # Produce model with Smartpls # Present the value of the mean, median, Cronbach's, T-test, Pearson Test, Reliability Test, etc. I will ensure the credibility and trustworthiness of preserving works.

are you know Rshiny well? if right, it will okay. Lets discuss more detail via zoom

Being a professional quantitative data analysis provider, I offer the following services: #Descriptive analysis of survey data with SPSS # Inferrential analysis of survey data with SPSS # Produce model with Smartpls # Present the value of the mean, median, Cronbach's, T-test, Pearson Test, Reliability Test, etc. I will ensure the credibility and trustworthiness of preserving works.

I have experience for more than 5 years doing qualitative data analysis with NVIVO. The service included: #Analysis data from Interview, FGD, Field Notes, Observation, and any text # Interview (Audio Transcription) #Content and Thematic Analysis # Producing tables, charts, maps, and figures of the themes # Producing word cloud #Produce Framework metrics

Looking for a SAS programmer to work on my Project

Looking for SAS programmer to guide in my new project

Looking for a SAS programmer who can guide me in my project

A manufacturing firm currently receives supplies of raw materials from Supplier A. They have recently been approached by Supplier B, so the firm will continue to use Supplier A unless they have significant evidence that the mean delivery time for Supplier B is lower. The SAS data set [login to view URL] contains data relating to a representative sample of 80 deliveries, 50 by supplier A and 30 by ...

A manufacturing firm currently receives supplies of raw materials from Supplier A. They have recently been approached by Supplier B, who has offered a more timely service. In order to investigate this claim, the firm has agreed to accept deliveries from Supplier B for a trial period in addition to those provided by Supplier A. The two suppliers have similar costs, so the firm will continue to use ...

Please Sign Up or Login to see details.

i need someone expert in r programming with some data set in covid 19 related easy task please inbiox

Do the last four weeks of my course

I need to learn how to match data using R CEM package based on several variables. I have a sample set of scientific data with several variables (Treatment vs non-treatment group). I would like to know who to identify matches using R coarsened exact matching (CEM). Identying matching cases using CEM in R studio I would like to match people who received TXA (n=15) in this small sample with the rema...

I am looking for part time and full developers for Clinical SAS. Who are familiar with ADaM , TLF SDTM, CDISC. (ONLY FOR INDEPENDENT INDIANS). Atleast 2-3 years experience.

research proposal, familiar with econometric and economic field.

Hi, I am looking for an expert to help in completing my research methodology and interpretation on the topic "Stock Price Movement around the Merger and Acquisition Announcements – An Event Study". Please bid your best price and timeline for completion of work. Thanks

i need someone expert in r programming with some data set in covid 19 related easy task please inbiox

I need someone who has idea about statistic and Excel and usual SPSS I will share the topics that I need to cover as a pdf file any one interested and knows about it text me please.

I need someone to analyze some data using SPSS software. Annova, Chi-square, etc. Only people who have the software and good experience with it need to apply. I need the work done in two days. Will share the files once I accept the bid.

need help with SAS coding challenge

I need some instructions in my course stochastic process and bayesian inference. Thanks

i need someone expert in r programming with some data set in covid 19 related easy task please inbox

i need someone expert in r programming with some data set in covid 19 related easy task please inbox

i need someone expert in r programming with some data set in covid 19 related easy task please inbox

i need someone expert in r programming with some data set in covid 19 related easy task please inbox

i need someone expert in r programming with some data set in covid 19 related easy task please inbiox

It is debugging project. I need help to debug my code

i need someone expert in r programming with some data set in covid 19 related easy task please inbiox

- Conduct profitability comparative analysis - Use software modeling to do linear regression analysis - Need methodology and result discussion

Data analysis should include: descriptive statistics, transition matrix, fixed/random effect, subgroup analysis (age, gender, income, etc)

I need someone to answer 3 data science related multi part questions which requires R programming. Please DM for more information. Need it in 2-3 days. The faster the better. Questions come with guidelines. Rates negotiable.

i have paper and i need to recreate the tables most important is the code it doesnt matter the result

The report is the following parts. [login to view URL] Self Organization Map [login to view URL] learning rate [login to view URL] Gaussian neighborhood size Please contact me $k.y.p or em.a.il. kulikov dot iurii2020 at g.m.a.i.l

Research paper about the best and unique solution of using both technologies of GIS and Machine Learning to support updating building footprint from raster date to vector data. The paper should not be less than 5 pages with introduction of GIS, Machine learning and the integration between them. Technology used, success stories, needed data( inputs), models, outputs, technology limitation, similar ...

We are from an IT consulting firm and an online tutoring company One of our client is in need of SAS Project Assistance which has to be completed in 2 to 3 days - on or before 10th April IST So only if you are available in these 2 days to do this kindly bid this project

I would like to implement a SAS program that analyzes the data. The SAS is supposed to create only 3 Reports based on a set of data.

I am looking for maths modeling code expert who can do my simple task. I will share detail.

3 Months, Part Time Virtual Okay, Puerto Rico preferred. Fluent in either Spanish or English Extensive experience in data analytics and statistical analysis. Can distill analyses into clear, key take-aways to drive team actions.