Statistical Analysis Jobs

Statistical analysis is a mathematical science, the practice of evaluating and understanding quantitative data. Statistical analysis will make sense of indexes such as standard deviation, and note outliers. The analysis of the data may aid in decision-making in the face of uncertainty.

Quantitative data is represented as numbers, and therefore may be presented in graph format. This simplifies the explanations and visualizations of the data’s meaning. The graph alone will show a positive or negative correlation, a bell curve, or no correlation at all.

Statistics require a population to be studied, and statistical analysis is commonly used regarding census data organized by governments, sociology and medicine.

Hire Statistical Analysers

Filter

My recent searches
Filter by:
Budget
to
to
to
Type
Skills
Languages
    Job State
    98 jobs found, pricing in AUD

    Need someone good expert in forecasting and case study

    $24 (Avg Bid)
    $24 Avg Bid
    4 bids
    Statistics Question helper 6 days left
    VERIFIED

    Need support in Statistics questions - practical questions.

    $33 (Avg Bid)
    $33 Avg Bid
    14 bids

    I need someone who can pull data (need to write a code in python to pull the data from the website and automate it). once you have the data then you need to analyze it, I will discuss those points in PM and finally prepare the presentation and provide recommendations. Thanks

    $140 (Avg Bid)
    $140 Avg Bid
    16 bids

    Statistical analysis is needed to be done for a secondary database, which needs descriptive statistical analysis to see the relationship between dependent and independent variables, also Chi-square tests and Logistic regression analysis. For a cross-sectional study in malnutrition.

    $146 (Avg Bid)
    $146 Avg Bid
    23 bids

    Analyze follower statistics, engagement Research strengths & weaknesses of current social media patterns Instagram, twitter & Facebook? Develop, implement and manage social media strategy and campaigns for Instagram, Twitter & Facebook Work with our Social Media Content Creator & Scheduler to create the best esthetics for each platforms to attract followers and create organic engag...

    $121 (Avg Bid)
    $121 Avg Bid
    15 bids

    Use the data to conduct profitability comparative analysis Use software modeling to do linear regression analysis. Need methodology and result discussion

    $176 (Avg Bid)
    $176 Avg Bid
    15 bids

    Logistic regression report, including: - Introduction - Exploratory analysis - From initial to final model - Results - Comments about the data/analysis - Interpretation and conclusions for a lay audience

    $247 (Avg Bid)
    $247 Avg Bid
    27 bids

    You are going to research on the issues concerning the use of data mining for (a) particular functional area(s). The suggested areas include, but not limited to: • Data Mining and Customer Relationship Management (CRM) • Data Mining and Marketing • Data Mining and Fraud Detection • Data Mining and Talent Management, etc.

    $150 (Avg Bid)
    $150 Avg Bid
    12 bids
    Article writing 6 days left
    VERIFIED

    A systematic review of the effectiveness of human resources and training in improving services and support for older people with mental health problems

    $104 (Avg Bid)
    $104 Avg Bid
    43 bids

    I need basic analysis on DNA Eg: ATGCCCCAACTAAATACCGCCGTATGACCCACCATAATTACCCCCATACTCCTGACACTATTTCTCGTCACCCAACTAAAAATATTAAATTCAAATTACCATCTACCCCCCTCACCAAAACCCATAAAAATAAAAAACTACAATAAACCCTGAGAACCAAAATGAACGAAAATCTATTCGCTTCATTCGCTGCCCCCACAATCCTAG

    $8 / hr (Avg Bid)
    $8 / hr Avg Bid
    3 bids

    Use the data to conduct profitability comparative analysis Use software modeling to do linear regression analysis. Need methodology and result discussion

    $106 (Avg Bid)
    $106 Avg Bid
    6 bids
    $13
    2 entries

    Being a professional quantitative data analysis provider, I offer the following services: #Descriptive analysis of survey data with SPSS # Inferrential analysis of survey data with SPSS # Produce model with Smartpls # Present the value of the mean, median, Cronbach's, T-test, Pearson Test, Reliability Test, etc. I will ensure the credibility and trustworthiness of preserving works.

    $188 (Avg Bid)
    $188 Avg Bid
    13 bids

    are you know Rshiny well? if right, it will okay. Lets discuss more detail via zoom

    $35 (Avg Bid)
    $35 Avg Bid
    5 bids

    Being a professional quantitative data analysis provider, I offer the following services: #Descriptive analysis of survey data with SPSS # Inferrential analysis of survey data with SPSS # Produce model with Smartpls # Present the value of the mean, median, Cronbach's, T-test, Pearson Test, Reliability Test, etc. I will ensure the credibility and trustworthiness of preserving works.

    $606 (Avg Bid)
    $606 Avg Bid
    4 bids

    I have experience for more than 5 years doing qualitative data analysis with NVIVO. The service included: #Analysis data from Interview, FGD, Field Notes, Observation, and any text # Interview (Audio Transcription) #Content and Thematic Analysis # Producing tables, charts, maps, and figures of the themes # Producing word cloud #Produce Framework metrics

    $525 (Avg Bid)
    $525 Avg Bid
    1 bids
    SAS Programming 5 days left

    Looking for a SAS programmer to work on my Project

    $1452 (Avg Bid)
    $1452 Avg Bid
    6 bids

    Looking for SAS programmer to guide in my new project

    $1612 (Avg Bid)
    $1612 Avg Bid
    6 bids

    Looking for a SAS programmer who can guide me in my project

    $1549 (Avg Bid)
    $1549 Avg Bid
    4 bids
    Statistical Data Analysis 5 days left
    VERIFIED

    A manufacturing firm currently receives supplies of raw materials from Supplier A. They have recently been approached by Supplier B, so the firm will continue to use Supplier A unless they have significant evidence that the mean delivery time for Supplier B is lower. The SAS data set [login to view URL] contains data relating to a representative sample of 80 deliveries, 50 by supplier A and 30 by ...

    $38 (Avg Bid)
    $38 Avg Bid
    5 bids
    Sas Data Analysis 5 days left
    VERIFIED

    A manufacturing firm currently receives supplies of raw materials from Supplier A. They have recently been approached by Supplier B, who has offered a more timely service. In order to investigate this claim, the firm has agreed to accept deliveries from Supplier B for a trial period in addition to those provided by Supplier A. The two suppliers have similar costs, so the firm will continue to use ...

    $39 (Avg Bid)
    $39 Avg Bid
    1 bids

    i need someone expert in r programming with some data set in covid 19 related easy task please inbiox

    $142 (Avg Bid)
    $142 Avg Bid
    10 bids
    $459 Avg Bid
    24 bids

    I need to learn how to match data using R CEM package based on several variables. I have a sample set of scientific data with several variables (Treatment vs non-treatment group). I would like to know who to identify matches using R coarsened exact matching (CEM). Identying matching cases using CEM in R studio I would like to match people who received TXA (n=15) in this small sample with the rema...

    $41 (Avg Bid)
    $41 Avg Bid
    5 bids
    Clinical SAS -- 2 5 days left
    VERIFIED

    I am looking for part time and full developers for Clinical SAS. Who are familiar with ADaM , TLF SDTM, CDISC. (ONLY FOR INDEPENDENT INDIANS). Atleast 2-3 years experience.

    $659 (Avg Bid)
    $659 Avg Bid
    3 bids

    research proposal, familiar with econometric and economic field.

    $30 (Avg Bid)
    $30 Avg Bid
    11 bids

    Hi, I am looking for an expert to help in completing my research methodology and interpretation on the topic "Stock Price Movement around the Merger and Acquisition Announcements – An Event Study". Please bid your best price and timeline for completion of work. Thanks

    $147 (Avg Bid)
    $147 Avg Bid
    6 bids

    i need someone expert in r programming with some data set in covid 19 related easy task please inbiox

    $201 (Avg Bid)
    $201 Avg Bid
    18 bids
    Excel/statistic 5 days left

    I need someone who has idea about statistic and Excel and usual SPSS I will share the topics that I need to cover as a pdf file any one interested and knows about it text me please.

    $126 (Avg Bid)
    $126 Avg Bid
    13 bids
    SPSS dada analysis 5 days left
    VERIFIED

    I need someone to analyze some data using SPSS software. Annova, Chi-square, etc. Only people who have the software and good experience with it need to apply. I need the work done in two days. Will share the files once I accept the bid.

    $33 (Avg Bid)
    $33 Avg Bid
    16 bids
    SAS program 4 days left
    VERIFIED

    need help with SAS coding challenge

    $28 (Avg Bid)
    $28 Avg Bid
    9 bids

    I need some instructions in my course stochastic process and bayesian inference. Thanks

    $56 (Avg Bid)
    $56 Avg Bid
    6 bids

    i need someone expert in r programming with some data set in covid 19 related easy task please inbox

    $174 (Avg Bid)
    $174 Avg Bid
    17 bids

    i need someone expert in r programming with some data set in covid 19 related easy task please inbox

    $198 (Avg Bid)
    $198 Avg Bid
    13 bids

    i need someone expert in r programming with some data set in covid 19 related easy task please inbox

    $182 (Avg Bid)
    $182 Avg Bid
    12 bids

    i need someone expert in r programming with some data set in covid 19 related easy task please inbox

    $184 (Avg Bid)
    $184 Avg Bid
    7 bids

    i need someone expert in r programming with some data set in covid 19 related easy task please inbiox

    $192 (Avg Bid)
    $192 Avg Bid
    11 bids
    R expert needed 4 days left

    It is debugging project. I need help to debug my code

    $28 (Avg Bid)
    $28 Avg Bid
    11 bids

    i need someone expert in r programming with some data set in covid 19 related easy task please inbiox

    $199 (Avg Bid)
    $199 Avg Bid
    22 bids

    - Conduct profitability comparative analysis - Use software modeling to do linear regression analysis - Need methodology and result discussion

    $34 (Avg Bid)
    $34 Avg Bid
    13 bids

    Data analysis should include: descriptive statistics, transition matrix, fixed/random effect, subgroup analysis (age, gender, income, etc)

    $163 (Avg Bid)
    $163 Avg Bid
    12 bids

    I need someone to answer 3 data science related multi part questions which requires R programming. Please DM for more information. Need it in 2-3 days. The faster the better. Questions come with guidelines. Rates negotiable.

    $495 (Avg Bid)
    $495 Avg Bid
    13 bids

    i have paper and i need to recreate the tables most important is the code it doesnt matter the result

    $157 (Avg Bid)
    $157 Avg Bid
    24 bids

    The report is the following parts. [login to view URL] Self Organization Map [login to view URL] learning rate [login to view URL] Gaussian neighborhood size Please contact me $k.y.p or em.a.il. kulikov dot iurii2020 at g.m.a.i.l

    $331 (Avg Bid)
    $331 Avg Bid
    4 bids

    Research paper about the best and unique solution of using both technologies of GIS and Machine Learning to support updating building footprint from raster date to vector data. The paper should not be less than 5 pages with introduction of GIS, Machine learning and the integration between them. Technology used, success stories, needed data( inputs), models, outputs, technology limitation, similar ...

    $1198 (Avg Bid)
    $1198 Avg Bid
    14 bids
    SAS Project Assistance -- 3 3 days left
    VERIFIED

    We are from an IT consulting firm and an online tutoring company One of our client is in need of SAS Project Assistance which has to be completed in 2 to 3 days - on or before 10th April IST So only if you are available in these 2 days to do this kindly bid this project

    $5 / hr (Avg Bid)
    $5 / hr Avg Bid
    1 bids

    I would like to implement a SAS program that analyzes the data. The SAS is supposed to create only 3 Reports based on a set of data.

    $35 (Avg Bid)
    $35 Avg Bid
    9 bids

    I am looking for maths modeling code expert who can do my simple task. I will share detail.

    $127 (Avg Bid)
    $127 Avg Bid
    5 bids

    3 Months, Part Time Virtual Okay, Puerto Rico preferred. Fluent in either Spanish or English Extensive experience in data analytics and statistical analysis. Can distill analyses into clear, key take-aways to drive team actions.

    $45 / hr (Avg Bid)
    $45 / hr Avg Bid
    9 bids

    Top Statistical Analysis Community Articles