Find Jobs
Hire Freelancers

Geneticist/Biologist only: Find out the disease causing mutation for 41 dog diseases plus frequencies .

€30-250 EUR

In Progress
Posted almost 8 years ago

€30-250 EUR

Paid on delivery
I have a list of 41 genetic diseases in dogs. I need the following: 1) Find out which gene is responsible for the disease as well as which mutation causes the disease. 2) Get the genomic sequence of dogs flanking the mutation so a genetic test can be designed for it. (I need at least 100 bases upstream and downstream with the mutation shown in brackets. in this format: ACTCGGAAATTCTCTTTATAGGATTCT(G/C)CGATCTCGAAAAGAGATCTTCTCG 3) Get me information if the disease is dominant, recessive or codominant 4) Get some information how common dis disease is in any dog breed I will supply an excel sheet to fill in the details. the results must be entered into this excel sheet.
Project ID: 10702680

About the project

4 proposals
Remote project
Active 8 yrs ago

Looking to make some money?

Benefits of bidding on Freelancer

Set your budget and timeframe
Get paid for your work
Outline your proposal
It's free to sign up and bid on jobs
Awarded to:
User Avatar
As an experienced researcher and professional & academic content writer in the field of biotechnology, biochemistry, microbiology, genetics, environmental science and medical science with in depth knowledge in genetics, I am competent enough to perform the said job with full satisfaction. I am a doctorate in Biotechnology pursuing postdoctoral research and has several years of experience in handling project designing, dissertation writing and making publications at graduate, post graduate and PhD level in subjects related to Biochemistry, Microbiology, Genetics, Biotechnology, Environmental Science and Medical Sciences. I have access to libraries of few leading Government Institutes and Universities of India making it easier to get authentic resources to complete the project. Thank you for your consideration and looking forward to hearing back from you.
€30 EUR in 3 days
5.0 (15 reviews)
3.6
3.6
4 freelancers are bidding on average €320 EUR for this job
User Avatar
Greetings from Italy, I have extensive experience in similar projects, so I am confident that I can provide you with high quality results on the topic at hand. By hiring me, your work is done professionally, on demand and 100% upto your satisfaction. My track record speaks for itself. I have worked and developed content for countless clients around the world. Let’s discuss the project details and I’ll assure that your job is done according to your specific instructions and prior to deadline. I look forward to working for you. Best regards
€1,000 EUR in 10 days
5.0 (2 reviews)
3.1
3.1
User Avatar
Hi employer, I like your project's theme and I wish to write on it. I promise to provide quality work in given time and price with no grammar and spelling mistakes. I hope you will like my proposal and give me a chance to get awarded. Regards, Raghav
€50 EUR in 3 days
4.4 (1 review)
0.6
0.6
User Avatar
Hello, I am a scientific writer and as you can see my profile, I can edit and write manuscripts in biology and its allied sciences (I am already in contract with few other clients for the almost the same kind of job). More importantly, I have also worked as an editor for one of my clients for online search and compilation of research papers for two specific topics. I can complete your assignment in six days (which includes mutual discussions, and any other changes suggested by you). The time and charges are negotiable. I feel I can do your job because I am a doctorate in Biotechnology, with more than seven years of experience in research and writing and editing (including thesis and articles). I have also published research papers in epigenetics and molecular characterization and if you wish to, I can provide the link to my papers. Please feel free to discuss the assignment with me. Regards, Prerna
€200 EUR in 6 days
0.0 (0 reviews)
0.0
0.0

About the client

Flag of AUSTRIA
Salzburg, Austria
5.0
312
Payment method verified
Member since Jul 4, 2011

Client Verification

Thanks! We’ve emailed you a link to claim your free credit.
Something went wrong while sending your email. Please try again.
Registered Users Total Jobs Posted
Freelancer ® is a registered Trademark of Freelancer Technology Pty Limited (ACN 142 189 759)
Copyright © 2024 Freelancer Technology Pty Limited (ACN 142 189 759)
Loading preview
Permission granted for Geolocation.
Your login session has expired and you have been logged out. Please log in again.